Lag1 longevity assurance homolog 2
WebLAG1 stands for Longevity Assurance Gene 1 Suggest new definition This definition appears frequently and is found in the following Acronym Finder categories: WebPrevious in vitro studies have demonstrated that LAG1 longevity assurance homolog 2 (LASS2) is a novel tumor suppressor gene that is significantly associated with the proliferation and invasion ability of tumor cells. However, the role LASS2 serves in regulating bladder cancer cell tumorigenicity and tumor growth in vivo has not yet been elucidated …
Lag1 longevity assurance homolog 2
Did you know?
WebApr 25, 2000 · Amino acid alignment of the L. esculentum ASC1 (Le) and A. thaliana LAG1 (At-1 and At-2) protein homologs. The ASC-1 and LAG1 At-1 homologs are 53% identical (black) and 73% similar (gray). The predicted TM spanning helices are underlined, the basic domain at amino acids 57–83 (in ASC1), the LAG1 motif at amino acid 151 (in ASC1), and … WebRPP312Hu01, SP260; L3; TMSG1; CerS2; Longevity Assurance(LAG1)Homolog 2; Ceramide Synthase 2; LAG1 Longevity Assurance Homolog 2; Tumor Metastasis Suppressor Gene …
WebJun 11, 2024 · LAG1 longevity assurance homolog 2 (LASS2), a highly conserved transmembrane protein, has been reported to be associated with nonalcoholic fatty liver … WebGene ID: 107894263, updated on 22-May-2024. Summary Other designations. LAG1 longevity assurance homolog 2, longevity assurance protein 1-like protein, longevity …
WebJun 1, 2016 · Select the department you want to search in ... WebHomo sapiens longevity assurance homolog 2 of yeast LAG1 (LASS2), also known as tumor metastasis suppressor gene 1 (TMSG1), was firstly cloned by our laboratory in 1999. However, its antitumor molecular mechanisms are still unclear. LASS2/TMSG-1 could directly interact with the C subunit of Vacuolar …
WebMar 29, 2024 · This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. ... LAG1 homolog, ceramide synthase 3, LAG1 longevity assurance homolog 3, dihydroceramide synthase 3, sphingosine N-acyltransferase …
WebCeramide synthase 5 (CerS5), also known as LAG1 longevity assurance homolog 5, and encoded by the gene name CERS5 or LASS5, belong to the LASS family representing a … stave 3 christmas carol pdfWebResearchGate. PDF) Upstream of Growth and Differentiation Factor 1 (uog1), a Mammalian Homolog of the Yeast Longevity Assurance Gene 1 (LAG1), RegulatesN-Stearoyl-sphinganine (C18-(Dihydro)ceramide) Synthesis in a Fumonisin B1-independent Manner in Mammalian Cells stave 3 christmas carol short summaryWebCeramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2) 1621: CerS2_REV: CCGTCTTCTGAGCCATCGTT: JH: 5/21/2015: 20: 55: O.lurida: Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2) 1620: GABABR1_FWD: CCGAGGAGGACACGAAACTC: JH: 5/21/2015: 20: 55: O.lurida: Gamma-aminobutyric acid … stave 3 full text a christmas carolWebHomo sapiens longevity assurance homolog 2 of yeast LAG1 (LASS2), a metastasis suppressor gene of human cancer, is the most abundantly expressed member of the ceramide synthase gene family. Expression of LASS2 has been reported in carcinomas of the prostate, liver and breast. However, there has been … stave 3 genius christmas carolWebMouse LAG1 longevity assurance homolog 1 (LASS1) ELISA Kit. Log in / Register; Product Type; Antibodies. Primary Antibodies; Recombinant Multiclonal; Secondary Antibodies; Tag and Loading Control Antibodies ... SARS-CoV-2 Antigens; Ubiquitination related reagent; CAR-T Cell Therapy Targets; Fc & Fc Receptor; Bio-Markers & CD Antigens; Interleukin; stave 3 in a christmas carolWebavailable via license: Creative Commons Attribution 4.0 International. Content may be subject to copyright. Download stave 3 plot summaryWebL3; LASS2; SP260; TMSG1; Ceramide synthase 2; CerS2; LAG1 longevity assurance homolog 2; Tumor metastasis-suppressor gene 1 protein: Background: LASS2 (LAG1 homolog, … stave 3 poverty quotes